# DNA Transition and Transversion Analysis Using Python
## Overview
This project performs DNA mutation analysis using Python by comparing two DNA sequences and identifying nucleotide substitutions.
The program calculates:
- Number of transitions
- Number of transversions
- Transition/Transversion ratio
Two different programming approaches are implemented to analyze DNA sequence mutations.
## Features
- Compare two DNA sequences
- Detect nucleotide substitutions
- Calculate transition mutations
- Calculate transversion mutations
- Calculate transition/transversion ratio
- Implement mutation analysis using two methods
## Technologies Used
- Python 3
- Bioinformatics Algorithms
- DNA Sequence Analysis
- Computational Biology
## Input DNA Sequences
### Sequence 1
GCAACGCACAACGAAAACCCTTAGGGACTGGATTATTTCGTGATCGTTGTAGTTATTGGAAGTACGGGCATCAACCCAGTT
### Sequence 2
TTATCTGACAAAGAAAGCCGTCAACGGCTGGATAATTTCGCGATCGTGCTGGTTACTGGCGGTACGAGTGTTCCTTTGGGT
## Bioinformatics Concepts
## 1. Transition Mutation
Transitions are substitutions between nucleotides of the same chemical group.
Purines:
A ↔ G
Pyrimidines:
C ↔ T
Examples:
A → G G → A C → T T → C
## 2. Transversion Mutation
Transversions are substitutions between different chemical groups.
Purine and pyrimidine changes:
A ↔ C A ↔ T G ↔ C G ↔ T
Examples:
A → C C → A A → T T → A G → C C → G G → T T → G
## Methods Implemented
## Method 1: Direct Condition Checking
The first approach checks every nucleotide position individually and identifies whether the mutation is a transition or transversion.
Example:
```python
if s1[i]=='A' and s2[i]=='G':
transition += 1
The second approach stores each nucleotide pair into variables and compares possible mutation combinations.
Example:
first = s1[x]
second = s2[x]This method improves code readability and reduces repetition.
The ratio is calculated using:
Transition / Transversion
Formula:
Ratio = Number of Transitions / Number of Transversions
This ratio helps measure evolutionary changes between DNA sequences.
- Clone the repository:
git clone https://github.com/FathimaNufla2000/DNA-Transition-Transversion-Analysis-Python.git- Navigate to the project directory:
cd DNA-Transition-Transversion-Analysis-Python- Run the Python file:
python transition_transversion.pyThe program displays:
- Total number of transition mutations
- Total number of transversion mutations
- Transition/transversion ratio
Example output:
No of Transition : X
No of Transversion : Y
Ratio : Z
Through this project, the following concepts are demonstrated:
- DNA sequence comparison
- Mutation classification
- Evolutionary sequence analysis
- Python conditional statements
- Loop-based sequence processing
- Basic bioinformatics programming
Transition and transversion analysis is useful in:
- Molecular evolution studies
- Genetic variation analysis
- Phylogenetic research
- Comparative genomics
Fathima Nufla
GitHub: https://github.com/FathimaNufla2000
This project is developed for educational purposes and bioinformatics learning.